Original Article

 

 

 

 

 

CYP2A6 Allele Frequencies in an Iranian Population

 

Masoumeh Emamghoreishi PhD*,**, Hamid-Reza Bokaee PhD*, Mojtaba Keshavarz Pharm D*, Abbas Ghaderi PhD***, Rachel F. Tyndale PhD

           


Authors' affiliations: *Department of Pharmacology, Medical School, **Psychiatry Research Center, ***Department of Immunology, Medical School, and Shiraz Institute for Cancer Research, Shiraz University of Medical Sciences, Shiraz, Iran. †Department of Pharmacology, University of Toronto, Center for Addiction and Mental Health, Toronto, Ontario, Canada.

•Corresponding author and reprints: Masoumeh Emamghoreishi PhD, Department of Pharmacology, Medical School, Shiraz University of Medical Sciences, Shiraz 7134853185, Iran. Telefax: +98-711-230-7591,

E-mail: emamm@sums.ac.ir

 

Accepted for publication: 14 May 2008


Background: Genetic polymorphism of CYP2A6 gene is a major causal factor in the large interindividual differences in nicotine metabolism. It may have an impact on smoking behavior and smoke-related cancer susceptibility. Until now, there are no reports of CYP2A6 allele frequencies in Iranian population.

Methods: In the present study, we investigated the frequencies of CYP2A6 alleles in 250 male Iranians. CYP2A6*2, CYP2A6*4, CYP2A6*9, and CYP2A6*12 were determined by allele-specific polymerase chain reaction.

Results: Frequencies of *2, *4, *9, and *12 alleles were 2.2%, 0.95%, 12.4%, and 1.34%, respectively.

Conclusion: These results showed that the distribution of CYP2A6 alleles in Iranian population was different from those reported previously for other ethnic groups. This highlights the importance of conducting further studies to investigate the implications on smoking dependence and cancer in Iranians.

 

 Archives of Iranian Medicine, Volume 11, Number 6, 2008: 613 – 617.

 

Keywords: CYP2A6 · Iran · polymorphism


 
Introduction
 

C

ytochromes P450 (CYPs), a superfamily of heme-containing mono-oxygenases, are involved in the metabolism of drugs, environmental pollutants, dietary chemicals, and endogenous compounds.1 Some genes belonging to CYP superfamily were shown to exhibit genetic polymorphisms with varying prevalences of poor metabolizers and extensive metabolizers. Among them is the hepatic isoform CYP2A6, which plays an important role in the metabolism of many xenobiotics. The CYP2A gene family is located on the long arm of human chromosome 19 (19q13.2), assembled   in   a  cluster  spanning 350 kb.  Three complete genes (CYP2A6, CYP2A7, and CYP2A-13) and two pseudogenes (CYP2A7PC and CYP2A7PT) were identified in this region. Among them, CYP2A6 and CYP2A13 encode active proteins, while CYP2A7 produces a catalytically defective enzyme. CYP2A6, first identified as the human coumarin 7-hydroxylase,2,3 is responsible for the metabolism of some drugs such as tegafur,4 methoxyflurane,5 halothane,6 disulfiram,7 and valproic acid.8 The CYP2A6 gene is highly polymorphic; to date, over 30 alleles have been reported although many are at low frequency or have not been characterized for functional impact.9 The wild type form of the CYP2A6 gene is termed CYP2A6*1. Among a variety of alleles, the CYP2A6*2 (SNP500Cancer ID: CYP2A6-01; 479T>A, L160H), CYP2A6*4 (whole gene deletion), and CYP2A6*5 (1436G>T, G479V) alleles are known to cause a lack of enzymatic activity. Also, the CYP2A6*6 (SNP500Cancer ID:CYP2A6-7; 383G>A, R128Q), CYP2A6*7 (SNP500Cancer ID:CYP2A6-03; 1412T>C, I471T), CYP2A6*9 (SNP500Cancer ID:CYP2A6-09; -48T>G), CYP2A6*10 (1412T>C and 1454G>T, I471T and R485L), CYP2A6*11 (670T>C, S224P), and CYP2A6*12 (2A6/2A7 hybrid; 10 amino acid substitutions) alleles are known to decrease enzymatic activity. The frequency of these alleles varies substantially among world populations.10 

Besides the involvement in the metabolism of drugs, CYP2A6 is responsible for a major metabolic pathway of nicotine.11 The genetic polymorphism of the CYP2A6 gene has been implicated for interindividual differences in nicotine metabolism.12–14 smoking behavior,15 and cigarette addiction.10 Additionally, CYP2A6 is involved in the activation of different tobacco- specific nitrosamines and procarcinogens. A relationship between the genetic polymorphisms of CYP2A6 and smoking-related cancers has also been reported.16,17 These are of particular interest as ethnic variation in frequencies for CYP2A6 variant alleles exist and may be related to the ethnic differences in nicotine metabolism, smoking behavior, and tobacco-related cancers. 

Given that the genetic polymorphism of CYP2A6 possesses some pharmacologic and toxicologic significance, and no data are available regarding the CYP2A6 genetic polymorphism in Iranian population, the aim of this study was to determine the CYP2A6 allele frequencies in Iranian population. Our study was focused on the frequency estimation of alleles *2, *4, *9, and *12 that are prevalent in Caucasians and Asians/Orientals and have been previously associated with smoking behaviors and/or smoking-related lung cancer.

 

Materials and Methods

 

Subjects

The study population consisted of 250 unrelated healthy male Iranian individuals from Fars Province, southern Iran. Their age range was 18 – 36 years with the mean (±SD) age of 36.30±10.56 years. The participants were smoker or nonsmoker blood donors referring to Iran's Blood Transfusion Center in Shiraz (Center of Fars Province).

They were physically healthy based on history, physical examination, and general health questionnaire (GHQ) administered by a physician. Written informed consent was obtained from the participants. This study was approved by the Medical Ethics Committee of Shiraz University of Medical Sciences.

 

Genomic DNA

Peripheral blood samples (8 mL) were collected from the participants by venous puncture. Genomic DNA was extracted from leukocytes by salting out method, as previously described.18 DNA samples were dissolved in distilled pyrogen free water. DNA concentrations were determined by spectrophotometry at 260 nm.

 

Genotyping of CYP2A6 alleles

CYP2A6 alleles were determined by using previously described two-step allele-specific polymerase chain reaction (PCR) assays.19–22 The first amplification uses genomic DNA as the template with CYP2A6 gene-specific primers and the second amplification uses DNA derived from the first PCR amplification with allele-specific primers. The primers used in this study are shown in Table 1. In each set of samples, three positive controls with different genotyping combinations and a negative control lacking DNA were included. The second amplification products were  analyzed on 1.5% or 2% agarose gels containing ethidium bromide. A 100-bp and 1-kb DNA ladder were used for each set of samples to confirm the appropriate amplicon size.

 

 

Table 1. Primers for CYP2A6*2, CYP2A6*4, CYP2A6*9, and CYP2A6*12 genotyping assay.

 

 

                                                         Primers (5` to 3`)       

 

 

Forward

Reverse

CYP2A6*2               

First step

GCTGAACACAGAGCAGATGTACA

GGAGGTTGACGTGAACTGGAAGA

 

Second step

CTCATCGACGCCCT

TCGTCCTGGGTGTTTTCCTTC

 

 

CTCATCGACGCCCA

 

CYP2A6*4               

First step

GGCCAAGATGCCCTACATG

GGAATAGGTGCTTTTTAAGAATC

 

Second step

ACCCACATTAGAAGCTTTCTAGA

GCTTTTTAAGAATCTGTCTAGAA

 

 

CCCCATTAGAAGCTTTCTACTCA

 

CYP2A6*9

First step

ACCTAGACTTAATCTTCCCGTATAC

CCCAAGATCCTGTCTTTCTGAT

 

Second step

ATCCTCCACAACAGAAGACCCCTAA

ACGGCTGGGGTGGTTTGCCTTTA

 

 

 

ACGGCTGGGGTGGTTTGCCTTTC

CYP2A6*12

First step

GCACCCCTCCTGAGGTACCAC

CGCTCCCCGTTGCTGAATA

 

Second step

TGGCTGTGTCCCAAGCTAGGCA

 

 

 

TGGCTGTGTCCCAAGCTAGGTG

 

 

 

Statistical analysis

Allele frequencies were derived by gene counting and using Hardy-Weinberg equation. The Chi square (χ2) test for goodness-of-fit was used to check whether the distribution of CYP2A6 genotypes in the population deviated from the Hardy-Weinberg equilibrium.

 

Results

 

The CYP2A6 alleles as well as genotype frequencies in the studied group are summarized in Table 2. A summary of the reaction conditions of the two PCRs used to detect the CYP2A6*2, *4, *9, and *12 alleles is provided in Table 3. Where no *2, *4, *9, or *12 alleles were detected, the allele was assigned to the default *1 wild type designation.

 

 

Table 2. CYP2A6 allele frequencies (%) and genotypes (%) in an Iranian population.

CYP2A6 genotypes

Percentage

Allele

Observed frequency %

(±95%CI)

*1/*2

2.8

CYP2A6*2

2.20 (±1.2)

*1/*4

1.4

CYP2A6*4

0.95 (±0.9)

*1/*9

23.1

CYP2A6*9

12.44 (±2.9)

*1/*12

2.6

CYP2A6*12

1.34 (±1)

*2/*2

0.1

 

 

*2/*9

0.84

 

 

*4/*9

0.47

 

 

 

 

The allele frequencies of CYP2A6*2, *4, *9, and *12 were 2.2%, 0.95%, 12.44%, and 1.34%, respectively. Alleles *9 and *4 had the highest and the lowest frequencies, respectively, in our study population. Homozygotes for CYP2A6*4, *9, and *12 alleles were not detected among studied subjects (Table 3). One participant was homozygous for CYP2A6*2. Three participants were heterozygotes for two genetic variants with decreased (*9) and lack of (*2 or *4) enzyme activity. The frequencies of the genotypes of CYP-2A6 alleles were within the 95% confidence interval (CI) estimated by the Hardy-Weinberg equation.

 

Table 3.  Reaction conditions for CYP2A6*2, CYP2A6*4, CYP2A6*9 and CYP2A6*12 two-step genotyping assays.

Reaction conditions

CYP2A6*2

CYP2A6*4

CYP2A6*9

CYP2A6*12

DNA

First step

(0.3 mg)

Second step

(1m l of first Amplification)

First step

(0.3 mg)

Second step

(1m l of first Amplification)

First step

(0.3 mg)

Second step

(1m l of first Amplification)

First step

(0.3 mg)

Second step

(1m l of first Amplification)

Primer (each) (mM)                        

0.4

0.5

0.5

0.5

0.5

0.5

0.06

0.5

Each dNTP (mM)                            

0.4

0.4

0.4

0.4

0.4

0.4

0.4

0.4

MgCl2 (mM)                                    

4

4

3.4

3.4

3

1.4

3.4

3.4

Taq polymerase (units)                    

2

2

2

2

2

2

2

2

Reaction step

 

 

 

 

 

 

 

 

Initial denaturation, °C (s)             

95 (60)

95 (60)

95 (60)

95 (60)

94 (60)

94 (60)

95 (60)

95 (60)

Denaturation, °C (s)                      

95 (15)

95 (15)

95 (15)

95 (15)

94 (15)

94 (20)

95 (15)

95 (15)

Annealing, °C (s)                          

60 (20)

50 (20)

52 (20)

50 (20)

55 (30)

68 (40)

58 (30)

65 (20)

Extension, °C (s)                           

72 (180)

72 (45)

72 (60)

72 (60)

72 (120)

72 (60)

72 (120)

72 (60)

# Cycles

36

20

35

25

35

20

38

25

Final extension, °C (min)              

72 (7)

72 (7)

72 (7)

72 (7)

 
Discussion
 

This is a report of CYP2A6 allele frequencies in an Iranian population. The study showed that the frequency of distribution of variant allele CYP2A6*2 in Iranians was 2.2%, which lies well within the ranges reported in previous studies. Previous studies reported a frequency of 1.1 to 3% in European and North-American Caucasians,19,20,23 and 0.0 – 0.7% in Orientals,13,20,21,23 for CYP2A6*2.  It is worth noting that the gene deletion mutation CYP2A6*4, which accounts for 6.7 – 24.2%13,20,21 of the CYP2A6 alleles in Asians, namely Orientals, had a low frequency (<1%) in Iranian population. Such a low *4 allele frequency was also reported for Caucasians (0.5 – 1.2%).20,21

The frequency of CYP2A6*9 allele in Iranian population (12.4%) was higher than that found in previous studies on Caucasians (5.2 – 7.2%),20,22 and lower than those of Orientals (15.6 –22.3%).20,22,24 The frequency of CYP2A6*12 allele in Iranian population (1.34%) was different from that reported for other populations with frequencies ranging from 0.0 – 0.8% in Orientals and to 2.0 –2.2% in Caucasians.20,25

There is no previous report examining the frequency of CYP2A6*2, *4, and *12 alleles in Iranian population. However, only one study examined the prevalence of CYP2A6*9 allele in Iranians in relation to esophageal cancer.26 The researchers compared the frequency of *9 allele in three Iranian groups who were geographically, ethnically, and religiously distinct. A higher frequency of *9 allele was reported in Turkmans (14%, from northeastern Iran) as compared with those of Turks (5%, from northwestern Iran) or Zoroastrians (4%, from Tehran).26 The frequency of 12.4% for CYP2A6*9 allele in the present study was close to that reported for Turkmans (14%), but higher than those of Turks and Zoroastrians.  This might be an indication that the difference in *9 allele frequencies between different Iranian population is related to the differences in their genetic make up rather than their geographic coverage. Further studies are needed to examine the CYP2A6 allele frequencies in different Iranian ethnical groups. 

The findings of this study should be viewed in the light of limitation of geographical coverage of the studied population. Nevertheless, the close similarity of the findings of the present study, in terms of the *9 allele frequency, with that of Turkmans who lived in northeastern Iran might indicate that the variation in allele frequencies is less likely to be geographically determined. Future studies examining CYP2A6 allele frequencies from different geographical parts of Iran will address this possibility.

In summary, the distribution of CYP2A6 alleles in the Iranian population is different than those of other ethnic groups. These differences highlight the importance of conducting further studies to investigate the implications on smoking dependence and cancer in Iranians.

 

Acknowledgment

 

This work was financially supported in part by a grant (82-1779) from Shiraz University of Medical Sciences. The authors are grateful to Ms Ewa Hoffmann for the training in CYP2A6 genotyping at the University of Toronto.

 

References

 

1         Nelson DR, Koymans L, Kamataki T, Stegeman JJ, Feyereisen R, Waxman DJ, et al. P450 superfamily: update on new sequences, gene mapping, accession numbers, and nomenclature. Pharmacogenetics. 1996; 6: 1 – 42.

2         Miles JS, McLaren AW, Forrester LM, Glancey MJ, Lang MA, Wolf CR. Identification of the human liver cytochrome P450 responsible for coumarin 7-hydroxylase activity. Biochem J. 1990; 267: 365 – 367.

3         Yamano S, Tatsuno J, Gonzalez FJ. The CYP2A6 gene product catalyses coumarin 7-hydroxylation in human liver microsomes. Biochemistry. 1990; 29: 1322 – 1329.

4         Ikeda K, Yoshisue K, Matsushima E, Nagayama S, Kobayashi K, Tyson CA, et al. Bioactivation of tegafur to 5-fluorouracil is catalyzed by cytochrome P-450 2A6 in human liver microsomes in vitro. Clin Cancer Res. 2000; 6: 4409 – 4415.

5         Kharasch ED, Hankins DC, Thummel KE. Human kidney methoxyfurane and sevofurane metabolism. Intrarenal fluoride production as a possible mechanism of methoxyfurane nephrotoxicity. Anesthesiology. 1995; 82: 689 – 699.

6         Spracklin DK, Hankins DC, Thummel KE. Cytochrome P450 2E1 is the principal catalyst of human oxidative halothane metabolism in vitro. J Pharmacol Exp Ther. 1997; 281: 400 – 411.

7         Madan A, Parkinson A, Faiman MD. Identification of the human and rat P450 enzymes responsible for the sulfoxidation of S-methyl N,N-diethylthiolcarbamate (DETC-ME). The terminal step in the bioactivation of disulfiram. Drug Metab Dispos. 1995; 23: 1153 – 1162.

8         Sadeque AJM, Fisher MB, Korzekwa KR, Gonzalez FJ, Rettie AE. Human CYP2C9 and CYP2A6 mediate formation of the hepatotoxin 4-end-valproic acid. J Pharmacol Exp Ther. 1997; 283: 698 – 703.

9         Ingelman-Sundberg M, Daly AK, Nebert DW. Homepage of the human cytochrome P450 (CYP) allele nomenclature committee. Available from: URL: http://www.imm.ki.se/updated. Accessed 4 September 2008.

10      Malaiyandi V, Sellers EM, Tyndale RF. Implication of CYP2A6 genetic variation for smoking behaviors and nicotine dependence. Clin Pharmacol Ther. 2005; 77: 145 – 158. 

11      Nakajima M, Yamamoto T, Nunoya K, Yokoi T, Nagashima K, Inoue K, et al. Role of human cytochrome P4502A6 in C-oxidation of nicotine. Drug Metab Dispos. 1996; 24: 1212 – 1217.

12      Nakajima M, Kwon JT, Tanaka N, Zenta T, Yamamoto Y, Yamamoto H, et al. Relationship between interindividual differences in nicotine metabolism and CYP2A6 genetic polymorphism in humans. Clin Pharmacol Ther. 2001; 69: 72 – 78.

13      Kwon JT, Nakajima M, Chai S, Yom YK, Kim HK, Yamazaki H, et al. Nicotine metabolism and CYP2A6 allele frequencies in Koreans. Pharmacogenetics. 2001; 11: 317 – 323.

14      Yoshida R, Nakajima M, Watanabe Y, Kwon JT, Yokoi T. Genetic polymorphism in human CYP2A6 gene causing impaired nicotine metabolism. Br J Clin Pharmacol. 2002; 54: 511 – 517.

15      Tyndale RF, Sellers EM. Variable CYP2A6-mediated nicotine metabolism alters smoking behavior and risk. Drug Metab Dispos. 2001; 29: 548 – 552.

16      Miyamoto M, Umetsu Y, Kunitoh H, Dosaka AH, Sawamura Y, Ariyoshi N, et al. CYP2A6 gene deletion reduces susceptibility to lung cancer. Biochem Biophys Res Commun. 1999; 261: 658 – 660.

17      Ariyoshi N, Miyamoto M, Umetsu Y, Kunitoh H, Dosaka AH, Sawamura Y, et al. Genetic polymorphism of CYP2A6 gene and tobacco-induced lung cancer risk in male smokers. Cancer Epidemiol Biomarkers Prev. 2002; 11: 890 – 894.

18      Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res. 1988; 16: 12 – 15.

19      Oscarson M, Gullsten H, Rautio A, Bernal ML, Sinues B, Dahl ML, et al. Genotyping of human cytochrome P450 2A6 (CYP2A6), a nicotine C-oxidase. FEBS Lett. 1998; 438: 201 215.

20      Schoedel KA, Hoffman EB, Rao Y, Sellers EM, Tyndale RF. Ethnic variation in CYP2A6 and association of genetically slow nicotine metabolism and smoking in adult Caucasians. Pharmacogenetics. 2004; 14: 615 – 626.

21      Oscarson M, McLellan RA, Gullsten H, Yue QY, Lang MA, Bernal ML, et al. Characterization and PCR-based detection of a CYP2A6 gene deletion found at a high frequency in a Chinese population. FEBS Lett. 1999; 448: 105 – 110.

22      Pitarque M, von Richter O, Oke B, Berkkan H, Oscarson M, Ingelman-Sundberg M. Identification of a single nucleotide polymorphism in the TATA box of the CYP2A6 gene: impairment of its promoter activity. Biochem Biophys Res Commun. 2001; 284: 455 – 460.

23      Chen GF, Tang YM, Green B, Lin DX, Guengerich FP, Daly AK, et al. Low frequency of CYP2A6 gene polymorphism as revealed by a one-step polymerase chain reaction  method. Pharmacogenetics. 1999; 9: 327 – 332.

24      Yoshida R, Nakajima M, Nishimura K, Tokudome S, Kwon JT, Yokoi T. Effects of polymorphism in promoter region of human CYP2A6 gene (CYP2A6*9) on expression level of messenger ribonucleic acid and enzymatic activity in vivo and in vitro. Clin Pharmacol Ther. 2003; 74: 69 – 76.

25      Oscarson M, McLellan RA, Asp V, Ledesma M, Bernal -Ruiz ML, Sinues B, et al. Characterization of a novel CYP2A7/CYP2A6 hybrid allele (CYP2A6*12) that causes reduced CYP2A6 activity. Hum Mutat. 2002; 20: 275 – 283.

26      Sepehr A, Kamangar F, Abnet CC, Fahimi S, Pourshams A, Poustchi H, et al. Genetic polymorphisms in three Iranian populations with different risks of esophageal cancer, an ecologic comparison. Cancer Letters. 2004; 213: 195 – 202.

 


AIM Home | Table of Contents