Phylogenetic of Human T-cell Lymphotropic Virus Type I in Iranians Born in Mashhad
R. Farid MD,* A. Shirdel MD,** M. Etemadi MD,H H. Rafatpanah MSc,*
H. Baradaran PhD,* F. Farid,* B. Nikbin MDI
Departments of *Immunology, **Internal Medicine and HUrology, Mashhad University of Medical Sciences, Mashhad, and IDepartment of Neurology, Tehran University of Medical Sciences, Tehran, Iran
Introduction
Previous surveys indicate that human T-cell lymphotropic virus type I (HTLV-1) is endemic in the city of Mashhad in northeastern Iran.1
HTLV-1 is the etiological agent of the CD4+ lymphoproliferative disease including adult T-cell leukemia (ATL)2 and HTLV-1 associated myelopathy3 which are both common in the area of this study.
Lack of uniformity in the geographic distribution of HTLV-1 suggests that this retrovirus is transmissible and that endemicity depends on the complex interactions between multiple environmental, social, behavioral and cultural factors.
This study was conducted to determine the phylogenesis of the HTLV-1 in this highly prevalent area.
Materials and Methods
Mashhad, the capital of Khorasan province in the Northeast of Iran, is a holy city of Shi'ite Islam and a cross roads for many pilgrims from the Islamic world.
Six Iranians born in Mashhad, four with ATL, one with spastic myelopathy and one asymptomatic HLTV-1 seropositive patient were studied. All participants in this study denied any blood transfusion or intravenous drug abuse.
Antibody against HTLV-1 was detected in sera of all patients by particle agglutination test (Fujirebio, Tokyo).
PCR and DNA sequencing
Genomic DNA was extracted from peripheral blood mononuclear cells (PBMC) of patients with T-cell leukemia as well as HAM patients. The cells were isolated by standard procedures and cultured after initial stimulation by phytohemagglutinin in RPMI medium as described by Gessain.4
LTR1, and LTR2 primers were used to amplify the LTR region of HTLV-1 located between nucleotides 9 and 746. One m g of ex vivo PBMC/DNA was used for each PCR and 35 cycles were performed using 4 DNA thermocyler (Perkin Elmer Gelus Corp, U.S.A.) with denaturation at 91?C for 1 min annealing at 58?C for 1 min and extending at 72?C for 2 min (with increased time of 25 cycle). Ten m l of the amplified product (738 bp long) was analyzed on 1.4% agarose (ultrapure agarose BRI. USA) gel which was transferred to a nylon filter and hybridized with the 32P labelled oligonucleotide LTR, probe to confirm the specificity of the PCR amplified product.
PCR, cloning and sequencing
Primers P3LTR(5'TTTGAGCGGCCGCYGACAATCACCATGAGCCCC3') and LTRUSE (5'ACTTAGAATTCCGCAGTTCAGGAGGCACCACAGGCG3') were used to amplify the totality of the U3 region and part of the R region of the LTR between nucleotides 1 and 459.
P3LTR and LTRUSE primers contain respectively the Not1, and Ecor1 restriction site sequences on their 5'. Amplification was performed under the same conditions as with LTR1, and LTR2 primers. After a phenol extraction and ethanol precipitation, the PCR product was digested with 10 minutes of Ecor1 and Not1 (Boehringer Mannheim, Germany) respectively. The digested DNA was purified by centrifugal filtration (Millipore, USA) and then inserted in linear Ecor1-Not1 pBluseScript vector and molecularly cloned. Positive clones were selected by using 32P labelled oligonucleotide (LTR3 or Rpx2) (5'CCATCCACGCCGGTTGAGTCGCGT3') as internal problem. For each sample the plasmid DNA from one or two positive recombinant clones were extracted, purified (Midiprep Qiagen, USA) and sequenced as described by Gessain (The Pasteur Institute of Paris, personal communication) and Farid.1
Results
Comparisons of HTLV-1 strains from the Mashhadi patients with the molecular data on HTLV-1 from Gabon, Mali and Reunion Island showed that the strains from Northeast of Iran belong to the cosmopolitan subtype.
Discussion
Genetic and phylogenetic analyses of gene sequences from six HTLV-1 infected patients from Mashhad in comparison to other strains of HTLV-1 indicate considerable nucleotide sequence similarity and a low degree of genetic heterogeneity. HTLV-1 strains from West and Central Africa and Japan (Gessain, Personal Communication, vidal et al 1994) all show significant similarities with the Iranian strains.
The city of Mashhad is an ancient site of pilgrimage holding the holy shrine of Imam Reza and is a cross-roads of migrating populations from surrounding regions. HTLV-1 is highly prevalent in this region. This study indicates that the specimens from six Mashhadi patients belong to the cosmopolitan subtype which in turn suggests the introduction of this virus to the city over the past several centuries.
The comparative importance of environmental, behavioral and social factors and the role of the other infectious agents which facilitate the long term maintenance of HTLV-1 within this region are unknown.
In this regard further studies are required to determine the genetic and phylogenetic relationship between HTLV-1 strain in Iran and other countries in the Middle East.
Acknowledge
We are indebted to Dr. A. Gessain and Prof. Gay from the Pasteur Institute of France who did PCR on our specimen and also Dr. B. Safai and Dr. S. Ahkami from USA for their considerable help and assistance.
References
1 Farid R, Etemadi M, et al. Seroepidemiology and virology of HTLV-1 in the city of Mashhad northeastern Iran. Infec Dis 1993; 5:251-2.
2 Farid R, Shirdel A, et al. Clinical Manifestation of Adult T-cell Lymphoma/Leukemia Associated with HTLV-1. Irn J Med Sci 1992; 17(3&4):105-8.
3 Gessain A. Antibody to HTLV-1 in patients with tropical spastic paraparesis. Lancet 1985; 8452:407-10.
4 Gessain A. Characterization of HTLV-1 isolates and T- Lymphoid cell lines derived from French west indian patients with tropical spastic paraparesis. Int J Cancer 1989; 13:327-33.
5 Gessain A. Complete nucleotide, sequence of a highly divergent HTLV-1 variant from Melanesia: Genetic and phylogenetic relationship of HTLV-1 strains from other geographical regions. J Virol 1993; 67:1015-23.
6 Vidal AU, Gessain A, Yoshida, et al. Phylogenetic classification of HTLV-1 genotypes in five major molecular and geographical subtypes. J General Virol 1994; 75:3655-66.